Stem-loop sequence dgr-mir-92b

AccessionMI0009178 (change log)
DescriptionDrosophila grimshawi miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   aa  u   - uga         u c       uu      u   au 
5'   cg cac c   uguaggucg g cuggugc  auuugu guu  g
     || ||| |   ||||||||| | |||||||  |||||| |||  u
3'   gc gug g   acguccggc c gaucacg  uaaaca uaa  g
   ac  u   a -ug         c u       -u      -   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14906: 3026549-3026639 [+]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-92b
dgr-mir-92ascaffold_14906: 3023263-3023349 [+]
dgr-mir-92bscaffold_14906: 3026549-3026639 [+]
Database links

Mature sequence dgr-miR-92b

Accession MIMAT0008624
Sequence

57 - 

aauugcacuagucccggccugc

 - 78

Get sequence
Evidence by similarity; MI0000379

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).