Stem-loop sequence dgr-mir-263a

AccessionMI0009172 (change log)
DescriptionDrosophila grimshawi miR-263a stem-loop
Gene family MIPF0000122; mir-263
Stem-loop
   --      g   a  ua   g     ga   au       -  uau 
5'   aucucg cac gu  aug cacug  aga  ucacggg gu   u
     |||||| ||| ||  ||| |||||  |||  ||||||| ||   u
3'   uagggc gug ua  uac gugau  ucu  agugccc ca   u
   ua      -   g  uc   g     uc   --       g  caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15126: 6621370-6621458 [-]
intergenic
Database links

Mature sequence dgr-miR-263a

Accession MIMAT0008621
Sequence

12 - 

guuaauggcacuggaagaauucac

 - 35

Get sequence
Evidence by similarity; MI0000343

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).