Stem-loop sequence dgr-mir-133

AccessionMI0009171 (change log)
DescriptionDrosophila grimshawi miR-133 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   ua    -     a             cauc  gu     -  auu 
5'   caac gcugu uguagcugguuga    gg  cagau cu   u
     |||| ||||| |||||||||||||    ||  ||||| ||   a
3'   guug ugacg augucgaccaacu    cc  guuua ga   u
   ua    g     -             -ucc  ug     u  gcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15126: 6389871-6389959 [+]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-133
dgr-mir-133scaffold_15126: 6389871-6389959 [+]
dgr-mir-288scaffold_15126: 6391674-6391769 [-]
Database links

Mature sequence dgr-miR-133

Accession MIMAT0008620
Sequence

55 - 

uugguccccuucaaccagcugu

 - 76

Get sequence
Evidence by similarity; MI0000362

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).