Stem-loop sequence dgr-mir-283

AccessionMI0009169 (change log)
DescriptionDrosophila grimshawi miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   cc     uc      aa           u         agcaaugcc 
5'   gauuc  aaaggu  auaucagcugg aauucuggg         a
     |||||  ||||||  ||||||||||| |||||||||         a
3'   uuaag  uuuuca  uaugguugacu uuaaggcuc         a
   --     uu      gc           -         acaaaguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14853: 6953521-6953614 [-]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-283
dgr-mir-283scaffold_14853: 6953521-6953614 [-]
dgr-mir-304scaffold_14853: 6952289-6952377 [-]
dgr-mir-12scaffold_14853: 6951722-6951795 [-]
Database links

Mature sequence dgr-miR-283

Accession MIMAT0008618
Sequence

15 - 

uaaauaucagcugguaauucu

 - 35

Get sequence
Evidence by similarity; MI0000368

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).