Stem-loop sequence dgr-mir-210

AccessionMI0009161 (change log)
DescriptionDrosophila grimshawi miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   --  -ag     ugg        gc   -         uuagau 
5'   gg   cuuau   agcugcug  cac ugcacaaga      u
     ||   |||||   ||||||||  ||| |||||||||      c
3'   cc   gaaug   ucggcgac  gug gcguguucu      a
   ga  aga     uua        -a   u         cagaaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15203: 8453544-8453629 [+]
intergenic
Database links

Mature sequence dgr-miR-210

Accession MIMAT0008613
Sequence

52 - 

uugugcgugugacagcggcua

 - 72

Get sequence
Evidence by similarity; MI0000376

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).