Stem-loop sequence dgr-mir-284

AccessionMI0009157 (change log)
DescriptionDrosophila grimshawi miR-284 stem-loop
Gene family MIPF0000228; mir-284
Stem-loop
   --         c              a   uguagcc      agga  -  u 
5'   guugcaguu cuggaauuaaguug cug       uguaag    ag gc u
     ||||||||| |||||||||||||| |||       ||||||    || ||  
3'   cggcguuaa gaccuuaguucaac gac       acauuc    uc cg g
   cu         c              -   ---ugaa      ---g  a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14906: 1700714-1700811 [+]
intergenic
Database links

Mature sequence dgr-miR-284

Accession MIMAT0008611
Sequence

64 - 

caaagucagcaacuugauuccagcaauug

 - 92

Get sequence
Evidence by similarity; MI0000369

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).