Stem-loop sequence dgr-mir-1

AccessionMI0009155 (change log)
DescriptionDrosophila grimshawi miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   --   uuu  --ga            c        a   -  a  u 
5'   gcc   ga    guuccaugcuuc uugcauuc aua gu ua a
     |||   ||    |||||||||||| |||||||| ||| || ||  
3'   cgg   cu    cgagguaugaag aauguaag uau cg au a
   ag   --u  aaag            a        g   a  a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15126: 6250416-6250502 [+]
intergenic
Database links

Mature sequence dgr-miR-1

Accession MIMAT0008609
Sequence

53 - 

uggaauguaaagaaguauggag

 - 74

Get sequence
Evidence by similarity; MI0000116

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).