Stem-loop sequence dgr-mir-87

AccessionMI0009154 (change log)
DescriptionDrosophila grimshawi miR-87 stem-loop
Gene family MIPF0000152; mir-87
Stem-loop
   -  u     auu        -u  c     g    ----------     c 
5'  ca auuuc   cgcgccug  au uugcu aacc          guuac a
    || |||||   ||||||||  || ||||| ||||          |||||  
3'  gu uaaag   guguggac  ua aacga uugg          cagug u
   u  u     agu        uu  a     g    ccuaaaccua     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15252: 3661321-3661412 [-]
intergenic
Database links

Mature sequence dgr-miR-87

Accession MIMAT0008608
Sequence

60 - 

uugagcaaaauuucaggugug

 - 80

Get sequence
Evidence by similarity; MI0000382

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).