Stem-loop sequence dgr-mir-6-5

AccessionMI0009148 (change log)
DescriptionDrosophila grimshawi miR-6-5 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
         c       u  ug   c       caaccauau 
5' uaacca agggaac gc  cug ugauaua         u
   |||||| ||||||| ||  ||| |||||||          
3' guuggu uuucuug cg  gac acuauau         u
         u       u  gu   -       cagcacaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_5621: 3535-3613 [+]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-6-5
dgr-mir-309-2scaffold_5621: 2525-2600 [+]
dgr-mir-3-2scaffold_5621: 2663-2728 [+]
dgr-mir-286-2scaffold_5621: 2821-2924 [+]
dgr-mir-4-2scaffold_5621: 2983-3063 [+]
dgr-mir-5-2scaffold_5621: 3132-3204 [+]
dgr-mir-6-4scaffold_5621: 3398-3467 [+]
dgr-mir-6-5scaffold_5621: 3535-3613 [+]
dgr-mir-6-6scaffold_5621: 3701-3774 [+]
Database links

Mature sequence dgr-miR-6

Accession MIMAT0008569
Sequence

53 - 

uaucacaguggcuguucuuuuu

 - 74

Get sequence
Evidence by similarity; MI0000126

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).