Stem-loop sequence dgr-mir-288

AccessionMI0009145 (change log)
DescriptionDrosophila grimshawi miR-288 stem-loop
Gene family MIPF0000223; mir-288
Stem-loop
   -           -------   ua  -  -u  ag     ag ug   a  a 
5'  ggccgugucgu       aau  gc ug  gc  aacgu  c  gcg ua u
    |||||||||||       |||  || ||  ||  |||||  |  ||| || u
3'  ccggcacagua       uua  ug ac  ug  uugca  g  ugc gu a
   g           cuuuacu   gc  u  uu  -g     cu gu   a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15126: 6391674-6391769 [-]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-288
dgr-mir-288scaffold_15126: 6391674-6391769 [-]
dgr-mir-133scaffold_15126: 6389871-6389959 [+]
Database links

Mature sequence dgr-miR-288

Accession MIMAT0008600
Sequence

65 - 

uuucaugucgauuucauuucaug

 - 87

Get sequence
Evidence by similarity; MI0000384

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).