Stem-loop sequence dgr-mir-287-2

AccessionMI0009144 (change log)
DescriptionDrosophila grimshawi miR-287-2 stem-loop
Gene family MIPF0000224; mir-287
Stem-loop
   ug    ---a   uu aa     gc           a 
5'   caua    ugc  g  auuuu  acacauuuaca u
     ||||    |||  |  |||||  ||||||||||| a
3'   gugu    acg  u  uaaaa  uguguaaaugu u
   -a    caac   uu gc     gu           u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_8166: 254-326 [+]
intergenic
Database links

Mature sequence dgr-miR-287

Accession MIMAT0008563
Sequence

45 - 

uguguugaaaaucguuugcac

 - 65

Get sequence
Evidence by similarity; MI0000381

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).