Stem-loop sequence dgr-mir-279

AccessionMI0009143 (change log)
DescriptionDrosophila grimshawi miR-279 stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   gu                    a     c  uguu     uuguuu 
5'   auuacuguuuuuagugggug ggguc ag    ucaca      a
     |||||||||||||||||||| ||||| ||    |||||      u
3'   ugauggcaaaaauuacucac ccuag uc    agugu      u
   cu                    a     a  ----     uuaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14624: 3249750-3249840 [+]
intergenic
Database links

Mature sequence dgr-miR-279

Accession MIMAT0008599
Sequence

58 - 

ugacuagauccacacucauuaa

 - 79

Get sequence
Evidence by similarity; MI0000363

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).