Stem-loop sequence dgr-mir-278

AccessionMI0009140 (change log)
DescriptionDrosophila grimshawi miR-278 stem-loop
Gene family MIPF0000155; mir-278
Stem-loop
   -u      acgg     c       c     a  a      u c   u 
5'   gauggu    ugcga cggauga gguuc ca cgaccg g uua u
     ||||||    ||||| ||||||| ||||| || |||||| | |||  
3'   uuaccg    auguu gccugcu ucagg gu gcuggu c aau u
   gu      --ca     u       u     -  g      - -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15112: 1314127-1314218 [-]
intergenic
Database links

Mature sequence dgr-miR-278

Accession MIMAT0008597
Sequence

58 - 

ucggugggacuuucguccguuu

 - 79

Get sequence
Evidence by similarity; MI0000361

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).