Stem-loop sequence dgr-mir-304

AccessionMI0009137 (change log)
DescriptionDrosophila grimshawi miR-304 stem-loop
Gene family MIPF0000308; mir-304
Stem-loop
       ca    a       aau       u    --   a   uua 
5' gcag  uuga uaaucuc   uuguaaa guga  gcg uua   a
   ||||  |||| |||||||   ||||||| ||||  ||| |||   g
3' cguu  agcu guuagag   aacguuu cacu  cgc agu   a
       ag    c       guu       -    ca   -   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14853: 6952289-6952377 [-]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-304
dgr-mir-283scaffold_14853: 6953521-6953614 [-]
dgr-mir-304scaffold_14853: 6952289-6952377 [-]
dgr-mir-12scaffold_14853: 6951722-6951795 [-]
Database links

Mature sequence dgr-miR-304

Accession MIMAT0008595
Sequence

12 - 

uaaucucaauuuguaaaugugag

 - 34

Get sequence
Evidence by similarity; MI0000411

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).