Stem-loop sequence dgr-mir-286-2

AccessionMI0009131 (change log)
DescriptionDrosophila grimshawi miR-286-2 stem-loop
Gene family MIPF0000225; mir-286
Stem-loop
   --         aaug    u   -    a         uugaaccuaaacuc      c 
5'   uuaaaauua    gcga ugu cggu uggucgcuu              uauaua a
     |||||||||    |||| ||| |||| |||||||||              |||||| a
3'   aauuuuaau    ugcu aca gcca aucagugaa              auauau u
   aa         aucg    c   a    g         --------------      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_5621: 2821-2924 [+]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-286-2
dgr-mir-309-2scaffold_5621: 2525-2600 [+]
dgr-mir-3-2scaffold_5621: 2663-2728 [+]
dgr-mir-286-2scaffold_5621: 2821-2924 [+]
dgr-mir-4-2scaffold_5621: 2983-3063 [+]
dgr-mir-5-2scaffold_5621: 3132-3204 [+]
dgr-mir-6-4scaffold_5621: 3398-3467 [+]
dgr-mir-6-5scaffold_5621: 3535-3613 [+]
dgr-mir-6-6scaffold_5621: 3701-3774 [+]
Database links

Mature sequence dgr-miR-286

Accession MIMAT0008590
Sequence

70 - 

ugacuagaccgaacacucgugcu

 - 92

Get sequence
Evidence by similarity; MI0000380

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).