Stem-loop sequence dgr-mir-9a

AccessionMI0009129 (change log)
DescriptionDrosophila grimshawi miR-9a stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   cu      u       uau      g     -  gau 
5'   auguug cuuuggu   cuagcu uauga gu   a
     |||||| |||||||   |||||| ||||| ||    
3'   uauaau gaagcca   gaucga auacu ca   a
   au      u       uuc      a     g  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15110: 23882750-23882824 [+]
intergenic
Database links

Mature sequence dgr-miR-9a

Accession MIMAT0008589
Sequence

9 - 

ucuuugguuaucuagcuguauga

 - 31

Get sequence
Evidence by similarity; MI0000129

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).