|
miRBase |
|
Stem-loop sequence dgr-mir-281-1 |
||||||
| Accession | MI0009128 | |||||
| Description | Drosophila grimshawi miR-281-1 stem-loop | |||||
| Gene family | MIPF0000087; mir-46 | |||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-46/mir-47/mir-281_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... In molecular biology, mir-46 (MI0000017) and mir-47 (MI0000018) are microRNA expressed in C. elegans from related hairpin precursor sequences. The predicted hairpin precursor sequences for Drosophila mir-281 (MI0000366, MI0000370) are also related and, hence, belong to this family. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequences are expressed from the 3' arms of the hairpin precursors. |
|||||
| Stem-loop |
aguga -ug c ccag ua cgaaua auaaagagagc uccgu gacagu ua a |||||| ||||||||||| ||||| |||||| || a gcuuau uguuucucucg aggua cuguca au u -agua uua - --ua uu |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence dgr-miR-281-1-5p |
|
| Accession | MIMAT0008587 |
| Previous IDs | dgr-miR-281-1* |
| Sequence |
15 - aagagagcuguccgucgacagu - 36 |
| Evidence | by similarity; MI0000366 |
Mature sequence dgr-miR-281-3p |
|
| Accession | MIMAT0008588 |
| Previous IDs | dgr-miR-281 |
| Sequence |
56 - ugucauggaauugcucucuuugu - 78 |
| Evidence | by similarity; MI0000366 |
References |
|
| 1 |
PMID:17994087
"Evolution of genes and genomes on the Drosophila phylogeny"
Nature. 450:203-218(2007).
|