Stem-loop sequence dgr-mir-31a

AccessionMI0009125 (change log)
DescriptionDrosophila grimshawi miR-31a stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
           ug       a     u         ---------  a    u 
5' ucuguugg  aauuggc agaug cggcauagc         ug cguu g
   ||||||||  ||||||| ||||| |||||||||         || ||||  
3' agguaacu  uugacug ucuac gucguaucg         ac gcga a
           ua       a     -         cgauauucu  -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15245: 16476673-16476763 [-]
intergenic
Database links

Mature sequence dgr-miR-31a

Accession MIMAT0008585
Sequence

14 - 

uggcaagaugucggcauagcuga

 - 36

Get sequence
Evidence by similarity; MI0000420

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).