Stem-loop sequence dgr-mir-285

AccessionMI0009121 (change log)
DescriptionDrosophila grimshawi miR-285 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --    au     a     ga    u      a    uaucguccaagaa 
5'   ucaa  ugaag acuga  ucga uggugc uaga             u
     ||||  ||||| |||||  |||| |||||| ||||              
3'   gguu  guuuc ugacu  agcu accacg aucu             a
   aa    au     g     aa    u      -    uaacuuuaauuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15110: 22570114-22570212 [-]
intergenic
Database links

Mature sequence dgr-miR-285

Accession MIMAT0008581
Sequence

66 - 

uagcaccauucgaaaucagugc

 - 87

Get sequence
Evidence by similarity; MI0000377

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).