Stem-loop sequence dgr-mir-309-1

AccessionMI0009118 (change log)
DescriptionDrosophila grimshawi miR-309-1 stem-loop
Gene family MIPF0000140; mir-3
Stem-loop
                 c ug      uu   -ca  uuu 
5' auuauauggcaaac u  uucagu  uga   ac   g
   |||||||||||||| |  ||||||  |||   ||   u
3' uaauaugcuguuug a  ggguca  acu   ug   u
                 a gu      cu   acg  ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15112: 2109142-2109217 [-]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-309-1
dgr-mir-309-1scaffold_15112: 2109142-2109217 [-]
dgr-mir-3-1scaffold_15112: 2109014-2109079 [-]
dgr-mir-286-1scaffold_15112: 2108818-2108921 [-]
dgr-mir-4-1scaffold_15112: 2108672-2108752 [-]
dgr-mir-5-1scaffold_15112: 2108531-2108603 [-]
dgr-mir-6-1scaffold_15112: 2108232-2108301 [-]
dgr-mir-6-2scaffold_15112: 2108086-2108164 [-]
dgr-mir-6-3scaffold_15112: 2107923-2107996 [-]
Database links

Mature sequence dgr-miR-309

Accession MIMAT0008577
Sequence

51 - 

ucacugggugaaguuugucgua

 - 72

Get sequence
Evidence by similarity; MI0000421

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).