Stem-loop sequence dgr-mir-276a

AccessionMI0009117 (change log)
DescriptionDrosophila grimshawi miR-276a stem-loop
Gene family MIPF0000124; mir-276
Stem-loop
   cc      uug   uc    a     ag        c uuaaau 
5'   ugguuu   cca  agcg gguau  aguuccua g      u
     ||||||   |||  |||| |||||  |||||||| |      u
3'   accaga   ggu  ucgu ccaua  ucaaggau c      a
   aa      --a   uc    g     cu        a ucauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15110: 12521941-12522029 [-]
intergenic
Database links

Mature sequence dgr-miR-276a-5p

Accession MIMAT0008575
Previous IDsdgr-miR-276a*
Sequence

16 - 

cagcgagguauagaguuccuacg

 - 38

Get sequence
Evidence by similarity; MI0000359

Mature sequence dgr-miR-276a-3p

Accession MIMAT0008576
Previous IDsdgr-miR-276a
Sequence

56 - 

uaggaacuucauaccgugcucu

 - 77

Get sequence
Evidence by similarity; MI0000359

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).