Stem-loop sequence dgr-mir-92a

AccessionMI0009113 (change log)
DescriptionDrosophila grimshawi miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --           gc   a     -     u   c    --ug a 
5'   auaaauugcuu  agg cggga aggug caa guuu    c u
     |||||||||||  ||| ||||| ||||| ||| ||||    | u
3'   uguuuggcgag  ucc gcccu uucac guu caaa    g u
   cg           ua   g     g     -   a    cuaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14906: 3023263-3023349 [+]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-92a
dgr-mir-92ascaffold_14906: 3023263-3023349 [+]
dgr-mir-92bscaffold_14906: 3026549-3026639 [+]
Database links

Mature sequence dgr-miR-92a

Accession MIMAT0008571
Sequence

53 - 

cauugcacuugucccggccuau

 - 74

Get sequence
Evidence by similarity; MI0000357

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).