Stem-loop sequence dgr-mir-2b

AccessionMI0009110 (change log)
DescriptionDrosophila grimshawi miR-2b stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
          c          -         a   --uuu  cuu 
5' uuguguc uucuucaaag ugguuguga aug     gc   u
   ||||||| |||||||||| ||||||||| |||     ||    
3' agcacag gaggaguuuc accgacacu uac     cg   u
          c          g         a   ucauc  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15126: 521329-521411 [+]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-2b
dgr-mir-2bscaffold_15126: 521329-521411 [+]
dgr-mir-2a-1scaffold_15126: 521655-521733 [+]
dgr-mir-2a-2scaffold_15126: 521957-522028 [+]
Database links

Mature sequence dgr-miR-2b

Accession MIMAT0008568
Sequence

54 - 

uaucacagccagcuuugaggagc

 - 76

Get sequence
Evidence by similarity; MI0000120

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).