Stem-loop sequence dgr-mir-184

AccessionMI0009109 (change log)
DescriptionDrosophila grimshawi miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   cc    c  u  ua         -     u  -  --cc      a 
5'   ggug au cg  cccuuauca uucuc cg cc    gugugg u
     |||| || ||  ||||||||| ||||| || ||    ||||||  
3'   ccac ua gc  gggaauagu aagag gc gg    cauauc a
   aa    -  u  uc         c     -  a  ucaa      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15245: 10719560-10719647 [-]
intergenic
Database links

Mature sequence dgr-miR-184-5p

Accession MIMAT0008566
Previous IDsdgr-miR-184*
Sequence

16 - 

ccuuaucauucucucgccccg

 - 36

Get sequence
Evidence by similarity; MI0000354

Mature sequence dgr-miR-184-3p

Accession MIMAT0008567
Previous IDsdgr-miR-184
Sequence

55 - 

uggacggagaacugauaagggc

 - 76

Get sequence
Evidence by similarity; MI0000354

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).