Stem-loop sequence dgr-mir-308

AccessionMI0009108 (change log)
DescriptionDrosophila grimshawi miR-308 stem-loop
Gene family MIPF0000171; mir-308
Stem-loop
              u       u    -   auu 
5' cucgcaguaua uuuugug uuug uuu   u
   ||||||||||| ||||||| |||| |||    
3' gagugucauau aggacac aaac aaa   u
              u       u    u   agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15245: 14076251-14076313 [-]
intergenic
Database links

Mature sequence dgr-miR-308

Accession MIMAT0008565
Sequence

42 - 

aaucacaggauuauacugugag

 - 63

Get sequence
Evidence by similarity; MI0000419

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).