Stem-loop sequence dgr-bantam

Accession MI0009102
Description Drosophila grimshawi bantam stem-loop
Gene family MIPF0000153; bantam
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled bantam_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology bantam microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
au     uac    c          uu      g   -   u 
  uugac   gaaa cgguuuucga  ugguuu acu guu u
  |||||   |||| ||||||||||  |||||| ||| ||| u
  aacug   uuuu gucgaaaguu  acuaga uga cag c
--     ---    a          uu      g   a   a 
Get sequence
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15110: 13265221-13265301 [-]
intergenic

Mature sequence dgr-bantam

Accession MIMAT0008559
Sequence

52 - 

ugagaucauuuugaaagcugauu

 - 74

Get sequence
Evidence by similarity; MI0000387

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).