Stem-loop sequence dgr-mir-277

AccessionMI0009099 (change log)
DescriptionDrosophila grimshawi miR-277 stem-loop
Gene family MIPF0000156; mir-277
Stem-loop
   ca       gc  -   gu    -            --  gaaac 
5'   guuuugg  ug cgu  cagg agugcauuugca  cu     a
     |||||||  || |||  |||| ||||||||||||  ||     u
3'   caagacc  ac gca  gucu ucacguaaaugu  ga     u
   ug       uu  a   ug    a            uc  aaguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14624: 2266198-2266286 [+]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-277
dgr-mir-277scaffold_14624: 2266198-2266286 [+]
dgr-mir-34scaffold_14624: 2267449-2267535 [+]
Database links

Mature sequence dgr-miR-277

Accession MIMAT0008556
Sequence

56 - 

uaaaugcacuaucugguacgaca

 - 78

Get sequence
Evidence by similarity; MI0000360

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).