Stem-loop sequence der-mir-289

AccessionMI0009098 (change log)
DescriptionDrosophila erecta miR-289 stem-loop
Gene family MIPF0000222; mir-289
Stem-loop
   ag     a  -aa      ua        g  ccugcg          cu 
5'   uuuac gu   aauaaa  uuuaagug ag      acuccagucc  c
     ||||| ||   ||||||  |||||||| ||      ||||||||||  u
3'   aaaug ca   uuguuu  gaguucac uc      uggggucagg  g
   ga     -  cgg      gc        -  ----aa          ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4784: 13614871-13614966 [+]
intergenic
Database links

Mature sequence der-miR-289

Accession MIMAT0008555
Sequence

15 - 

uaaauauuuaaguggagccugcgacu

 - 40

Get sequence
Evidence by similarity; MI0000385

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).