Stem-loop sequence der-mir-13a

AccessionMI0009092 (change log)
DescriptionDrosophila erecta miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
       u     c      -        a   --uc  cu 
5' uacg aacuc ucaaag gguuguga aug    ga  a
   |||| ||||| |||||| |||||||| |||    ||   
3' gugc uugag aguuuu ccgacacu uac    cu  u
       u     u      a        a   ucau  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4770: 10769404-10769478 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-13a
der-mir-2cscaffold_4770: 10769607-10769708 [-]
der-mir-13ascaffold_4770: 10769404-10769478 [-]
der-mir-13b-1scaffold_4770: 10769273-10769340 [-]
Database links

Mature sequence der-miR-13a

Accession MIMAT0008550
Sequence

48 - 

uaucacagccauuuugaugagu

 - 69

Get sequence
Evidence by similarity; MI0000133

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).