Stem-loop sequence der-mir-124

Accession

MI0009088

Description

Drosophila erecta miR-124 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

ua     uu   c      c      ag    a    uau 
  cguuu  cuc ugguau cacugu  gccu uaug   u
  |||||  ||| |||||| ||||||  |||| ||||   u
  gcaag  gag accgua guggcg  cgga auac   c
ac     -c   a      a      ca    -    cac 

Genome context

• Coordinates (dere_r1.3_FB2010_02): scaffold_4845: 6683979-6684059 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from der-mir-124

• der-mir-124: scaffold_4845: 6683979-6684059 [-]
• der-mir-287: scaffold_4845: 6676092-6676181 [-]

Mature sequence der-miR-124

• Accession: MIMAT0008547
• Sequence: 49 - uaaggcacgcggugaaugccaag - 71
• Evidence: by similarity; MI0000373

References

1. PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).