Stem-loop sequence der-mir-33

AccessionMI0009086 (change log)
DescriptionDrosophila erecta miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   ca      a    a  -g       u   c c        ucc a 
5'   gagaug cacg ag  ugcauug agu g auugucug   c a
     |||||| |||| ||  ||||||| ||| | ||||||||   |  
3'   cuuuac gugu uc  acgugac uca c uaacggac   g u
   ca      -    c  ga       u   a a        uuc u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4784: 19550587-19550676 [+]
intergenic
Database links

Mature sequence der-miR-33

Accession MIMAT0008545
Sequence

15 - 

aggugcauuguagucgcauug

 - 35

Get sequence
Evidence by similarity; MI0000364

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).