Stem-loop sequence der-mir-2c

AccessionMI0009081 (change log)
DescriptionDrosophila erecta miR-2c stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
      uau    c  u       -      aag     aagaaagauauuucu 
5' ucg   cuua uu caauguc aucaaa   ggcug               g
   |||   |||| || ||||||| ||||||   |||||                
3' agc   gagu aa guuacgg uaguuu   ccgac               c
      uac    -  c       g      cga     acuaugcuaaguuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4770: 10769607-10769708 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-2c
der-mir-2cscaffold_4770: 10769607-10769708 [-]
der-mir-13ascaffold_4770: 10769404-10769478 [-]
der-mir-13b-1scaffold_4770: 10769273-10769340 [-]
Database links

Mature sequence der-miR-2c

Accession MIMAT0008540
Sequence

63 - 

uaucacagccagcuuugaugggc

 - 85

Get sequence
Evidence by similarity; MI0000431

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).