Stem-loop sequence der-mir-1

AccessionMI0009075 (change log)
DescriptionDrosophila erecta miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   ca   ugu  --ga            c        a   -   au 
5'   gcc   ga    guuccaugcuuc uugcauuc aua guu  a
     |||   ||    |||||||||||| |||||||| ||| |||  c
3'   cgg   cu    cgagguaugaag aauguaag uau cga  u
   ag   --u  aaag            a        g   a   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 3954276-3954363 [-]
intergenic
Database links

Mature sequence der-miR-1

Accession MIMAT0008534
Sequence

54 - 

uggaauguaaagaaguauggag

 - 75

Get sequence
Evidence by similarity; MI0000116

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).