Stem-loop sequence der-mir-4

AccessionMI0009073 (change log)
DescriptionDrosophila erecta miR-4 stem-loop
Gene family MIPF0000305; mir-4
Stem-loop
    ug    u gu   uu    c   c   cuuag    - uu 
5' u  caau a  uuc  uggu guc agc     guga c  u
   |  |||| |  |||  |||| ||| |||     |||| |   
3' g  guug u  aag  acca cag ucg     uacu g  u
    gu    c ug   uu    a   a   --aaa    a uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 9749045-9749125 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-4
der-mir-309scaffold_4845: 9749455-9749523 [-]
der-mir-3scaffold_4845: 9749344-9749412 [-]
der-mir-286scaffold_4845: 9749180-9749277 [-]
der-mir-4scaffold_4845: 9749045-9749125 [-]
der-mir-5scaffold_4845: 9748917-9748980 [-]
der-mir-6-1scaffold_4845: 9748765-9748835 [-]
der-mir-6-2scaffold_4845: 9748628-9748700 [-]
der-mir-6-3scaffold_4845: 9748475-9748554 [-]
Database links

Mature sequence der-miR-4

Accession MIMAT0008532
Sequence

49 - 

auaaagcuagacaaccauuga

 - 69

Get sequence
Evidence by similarity; MI0000122

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).