Stem-loop sequence der-mir-314

AccessionMI0009069 (change log)
DescriptionDrosophila erecta miR-314 stem-loop
Gene family MIPF0000246; mir-314
Stem-loop
   u  u       g     u   au     uaguu    ---a       ca 
5'  cg aacuugu uggcu cga  guacc     gagg    agaaucc  u
    || ||||||| ||||| |||  |||||     ||||    |||||||   
3'  gc uugaaua accga gcu  uaugg     cucc    uuuuagg  g
   g  -       -     -   --     ----u    auug       cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4784: 11743724-11743813 [+]
intergenic
Database links

Mature sequence der-miR-314

Accession MIMAT0008528
Sequence

70 - 

uauucgagccaauaaguucgg

 - 90

Get sequence
Evidence by similarity; MI0000426

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).