Stem-loop sequence der-mir-79

AccessionMI0009064 (change log)
DescriptionDrosophila erecta miR-79 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   ag    -cuu    u        cgc       g     --   au 
5'   cugc    gcca ugcuuugg   uuuagcu uauga  uag  u
     ||||    |||| ||||||||   ||||||| |||||  |||  u
3'   gacg    cggu acgaaacc   agaucga auacu  auc  a
   ua    ucuu    u        auu       a     uc   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 19768203-19768294 [+]
intergenic
Clustered miRNAs
< 10kb from der-mir-79
der-mir-9cscaffold_4845: 19767535-19767626 [+]
der-mir-306scaffold_4845: 19768055-19768139 [+]
der-mir-79scaffold_4845: 19768203-19768294 [+]
der-mir-9bscaffold_4845: 19768390-19768478 [+]
Database links

Mature sequence der-miR-79

Accession MIMAT0008525
Sequence

57 - 

uaaagcuagauuaccaaagcau

 - 78

Get sequence
Evidence by similarity; MI0000374

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).