Stem-loop sequence der-mir-6-1

AccessionMI0009051 (change log)
DescriptionDrosophila erecta miR-6-1 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
   ag             ug c   c    ag uaau 
5'   uagagggaauagu  c gug ugua  u    a
     |||||||||||||  | ||| ||||  |    u
3'   guuuuucuugucg  g cac auau  a    a
   au             gu a   u    cu uacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 9748765-9748835 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-6-1
der-mir-309scaffold_4845: 9749455-9749523 [-]
der-mir-3scaffold_4845: 9749344-9749412 [-]
der-mir-286scaffold_4845: 9749180-9749277 [-]
der-mir-4scaffold_4845: 9749045-9749125 [-]
der-mir-5scaffold_4845: 9748917-9748980 [-]
der-mir-6-1scaffold_4845: 9748765-9748835 [-]
der-mir-6-2scaffold_4845: 9748628-9748700 [-]
der-mir-6-3scaffold_4845: 9748475-9748554 [-]
Database links

Mature sequence der-miR-6

Accession MIMAT0008504
Sequence

47 - 

uaucacaguggcuguucuuuuu

 - 68

Get sequence
Evidence by similarity; MI0000124

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).