Stem-loop sequence der-mir-2a-2

Accession MI0009049
Description Drosophila erecta miR-2a-2 stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    a   c        --             - aua 
aucu agc ucaucaag  ugguugugauaug g   c
|||| ||| ||||||||  ||||||||||||| |    
uagg ucg aguaguuu  accgacacuauac c   c
    a   -        cg             g aac 
Get sequence
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 4720203-4720274 [+]
intergenic
Clustered miRNAs
< 10kb from der-mir-2a-2
der-mir-2b-2 scaffold_4845: 4719526-4719608 [+]
der-mir-2a-1 scaffold_4845: 4719807-4719882 [+]
der-mir-2a-2 scaffold_4845: 4720203-4720274 [+]

Mature sequence der-miR-2a

Accession MIMAT0008510
Sequence

44 - 

uaucacagccagcuuugaugagc

 - 66

Get sequence
Evidence by similarity; MI0000118

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).