Stem-loop sequence der-mir-34

AccessionMI0009046 (change log)
DescriptionDrosophila erecta miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   ug   a  -   uu        u  u   c        u  ccaa    u 
5'   gcu ug cgc  uggcagug gg uag ugguugug ag    ucau g
     ||| || |||  |||||||| || ||| |||||||| ||    |||| c
3'   cga ac gcg  gccgucac uc auc accgacac uc    agug u
   --   -  a   cc        u  u   -        -  -aac    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4770: 15673314-15673409 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-34
der-mir-277scaffold_4770: 15674296-15674393 [-]
der-mir-34scaffold_4770: 15673314-15673409 [-]
Database links

Mature sequence der-miR-34

Accession MIMAT0008508
Sequence

14 - 

uggcagugugguuagcugguug

 - 35

Get sequence
Evidence by similarity; MI0000371

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).