Stem-loop sequence der-mir-11

AccessionMI0009038 (change log)
DescriptionDrosophila erecta miR-11 stem-loop
Gene family MIPF0000252; mir-11
Stem-loop
     a   gc         ucu      cc    u  acu 
5' gc cuu  caagaacuu   cuguga  ugcg gu   g
   || |||  |||||||||   ||||||  |||| ||    
3' cg gag  guucuugag   gacacu  acgc cg   a
     c   uc         ucu      --    -  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4770: 4217182-4217256 [+]
intergenic
Database links

Mature sequence der-miR-11

Accession MIMAT0008500
Sequence

48 - 

caucacagucugaguucuugc

 - 68

Get sequence
Evidence by similarity; MI0000131

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).