Stem-loop sequence der-mir-307

AccessionMI0009035 (change log)
DescriptionDrosophila erecta miR-307 stem-loop
Gene family MIPF0000293; mir-67
Stem-loop
   u        -   a         ccu  g       -u    uc 
5'  gucuugcu uug cucacucaa   gg ugugaug  uauu  g
    |||||||| ||| |||||||||   || |||||||  ||||  a
3'  caggacga agc gagugaguu   cc acacuac  augg  u
   a        u   -         ccu  a       cu    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4929: 8848884-8848971 [+]
intergenic
Database links

Mature sequence der-miR-307

Accession MIMAT0008497
Sequence

56 - 

ucacaaccuccuugagugag

 - 75

Get sequence
Evidence by similarity; MI0000418

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).