Stem-loop sequence der-mir-306

AccessionMI0009033 (change log)
DescriptionDrosophila erecta miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
   -g      c  ug  u       uu           --   - u 
5'   uccacu gg  gc cagguac  agugacucuca  aug c u
     |||||| ||  || |||||||  |||||||||||  ||| |  
3'   ggguga cc  cg guccgug  ucacugggggu  uac g u
   ca      -  gu  u       uc           uu   a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 19768055-19768139 [+]
intergenic
Clustered miRNAs
< 10kb from der-mir-306
der-mir-9cscaffold_4845: 19767535-19767626 [+]
der-mir-306scaffold_4845: 19768055-19768139 [+]
der-mir-79scaffold_4845: 19768203-19768294 [+]
der-mir-9bscaffold_4845: 19768390-19768478 [+]
Database links

Mature sequence der-miR-306-5p

Accession MIMAT0008494
Previous IDsder-miR-306
Sequence

15 - 

ucagguacuuagugacucucaa

 - 36

Get sequence
Evidence by similarity; MI0000414

Mature sequence der-miR-306-3p

Accession MIMAT0008495
Previous IDsder-miR-306*
Sequence

52 - 

gggggucacucugugccugugc

 - 73

Get sequence
Evidence by similarity; MI0000414

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).