Stem-loop sequence der-mir-286

AccessionMI0009030 (change log)
DescriptionDrosophila erecta miR-286 stem-loop
Gene family MIPF0000225; mir-286
Stem-loop
   --         aaug    a   -    a     u    -   -aaa  a 
5'   uuaaaauug    gcga ugu cggu ugguc cuuu uuc    ga g
     |||||||||    |||| ||| |||| ||||| |||| |||    || g
3'   aauuuuaau    ugcu aca gcca aucag gaag gag    cu u
   aa         aucg    c   a    g     u    c   cuag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 9749180-9749277 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-286
der-mir-309scaffold_4845: 9749455-9749523 [-]
der-mir-3scaffold_4845: 9749344-9749412 [-]
der-mir-286scaffold_4845: 9749180-9749277 [-]
der-mir-4scaffold_4845: 9749045-9749125 [-]
der-mir-5scaffold_4845: 9748917-9748980 [-]
der-mir-6-1scaffold_4845: 9748765-9748835 [-]
der-mir-6-2scaffold_4845: 9748628-9748700 [-]
der-mir-6-3scaffold_4845: 9748475-9748554 [-]
Database links

Mature sequence der-miR-286

Accession MIMAT0008491
Sequence

64 - 

ugacuagaccgaacacucgugcu

 - 86

Get sequence
Evidence by similarity; MI0000380

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).