Stem-loop sequence der-mir-311a

AccessionMI0009028 (change log)
DescriptionDrosophila erecta miR-311a stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
   ua    gu       -a    auc  c u      -   cu 
5'   gaua  uuuucgg  cggu   ug g caauau uuc  u
     ||||  |||||||  ||||   || | |||||| |||  g
3'   cuau  aaaaguc  gcca   ac c guuaua aag  u
   aa    --       cg    cuu  a -      u   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 10616549-10616628 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-311a
der-mir-992-1scaffold_4845: 10619176-10619234 [-]
der-mir-991-2scaffold_4845: 10619061-10619123 [-]
der-mir-2498ascaffold_4845: 10618951-10619010 [-]
der-mir-9681scaffold_4845: 10618728-10618783 [-]
der-mir-311b-2scaffold_4845: 10618294-10618368 [-]
der-mir-312-1scaffold_4845: 10618162-10618227 [-]
der-mir-311cscaffold_4845: 10618008-10618087 [-]
der-mir-310bscaffold_4845: 10617892-10617979 [-]
der-mir-992-2scaffold_4845: 10617702-10617760 [-]
der-mir-991-1scaffold_4845: 10617587-10617649 [-]
der-mir-2498bscaffold_4845: 10617479-10617536 [-]
der-mir-311b-1scaffold_4845: 10616837-10616911 [-]
der-mir-312-2scaffold_4845: 10616702-10616770 [-]
der-mir-311ascaffold_4845: 10616549-10616628 [-]
der-mir-310ascaffold_4845: 10616434-10616521 [-]
Database links

Mature sequence der-miR-311a-5p

Accession MIMAT0037337
Sequence

13 - 

cggacgguaucugcgucaauauu

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence der-miR-311a-3p

Accession MIMAT0008489
Sequence

50 - 

uauugcacauucaccggccuga

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).