Stem-loop sequence der-mir-100

AccessionMI0009027 (change log)
DescriptionDrosophila erecta miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -c    a     aa       au   aa      - u uuu 
5'   cauu acaga  cccguaa  ccg  cuugug c g   u
     |||| |||||  |||||||  |||  |||||| | |    
3'   guaa ugucu  ggguauu  ggc  gaacau g c   a
   ac    c     ga       ac   ca      u u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 5800037-5800118 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-100
der-mir-100scaffold_4845: 5800037-5800118 [-]
der-let-7scaffold_4845: 5799416-5799493 [-]
der-mir-125scaffold_4845: 5799104-5799213 [-]
Database links

Mature sequence der-miR-100

Accession MIMAT0008488
Sequence

12 - 

aacccguaaauccgaacuugug

 - 33

Get sequence
Evidence by similarity; MI0000378

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).