Stem-loop sequence der-mir-309

AccessionMI0009026 (change log)
DescriptionDrosophila erecta miR-309 stem-loop
Gene family MIPF0000140; mir-3
Stem-loop
         c       c   uu    u   c aau 
5' auuaua gacaaac uug  cggu uug c   u
   |||||| ||||||| |||  |||| ||| |   u
3' uaauau cuguuug aau  guca gac g   c
         c       a   gg    c   c auc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 9749455-9749523 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-309
der-mir-309scaffold_4845: 9749455-9749523 [-]
der-mir-3scaffold_4845: 9749344-9749412 [-]
der-mir-286scaffold_4845: 9749180-9749277 [-]
der-mir-4scaffold_4845: 9749045-9749125 [-]
der-mir-5scaffold_4845: 9748917-9748980 [-]
der-mir-6-1scaffold_4845: 9748765-9748835 [-]
der-mir-6-2scaffold_4845: 9748628-9748700 [-]
der-mir-6-3scaffold_4845: 9748475-9748554 [-]
Database links

Mature sequence der-miR-309

Accession MIMAT0008487
Sequence

44 - 

gcacuggguaaaguuuguccua

 - 65

Get sequence
Evidence by similarity; MI0000421

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).