Stem-loop sequence der-mir-287

AccessionMI0009022 (change log)
DescriptionDrosophila erecta miR-287 stem-loop
Gene family MIPF0000224; mir-287
Stem-loop
   ga   uggauguaug   -   ug   ucugaa     gc           a 
5'   cgc          ggu gug  ggc      auuuu  acacauuuaca u
     |||          ||| |||  |||      |||||  ||||||||||| a
3'   gcg          uca cac  uug      uaaaa  uguguaaaugu a
   -a   ----------   g   gu   -----c     gu           u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 6676092-6676181 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-287
der-mir-124scaffold_4845: 6683979-6684059 [-]
der-mir-287scaffold_4845: 6676092-6676181 [-]
Database links

Mature sequence der-miR-287

Accession MIMAT0008483
Sequence

62 - 

uguguugaaaaucguuugcac

 - 82

Get sequence
Evidence by similarity; MI0000381

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).