Stem-loop sequence dan-mir-311b

AccessionMI0009013 (change log)
DescriptionDrosophila ananassae miR-311b stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
   ca       a   u  uu  g    a    ac   u 
5'   uuuccag cug gg  ug gcag uacu  auu u
     ||||||| ||| ||  || |||| ||||  |||  
3'   aaagguc gac cc  ac cguu auga  uag a
   --       c   c  uu  a    -    -c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 4132538-4132607 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-311b
dan-mir-311bscaffold_13266: 4132538-4132607 [+]
dan-mir-312scaffold_13266: 4132689-4132745 [+]
dan-mir-311ascaffold_13266: 4132931-4133008 [+]
dan-mir-310scaffold_13266: 4133049-4133138 [+]
Database links

Mature sequence dan-miR-311b

Accession MIMAT0008475
Sequence

46 - 

uauugcacauuccccagccugg

 - 67

Get sequence
Evidence by similarity; MI0000423

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).