Stem-loop sequence dan-mir-311a

AccessionMI0009008 (change log)
DescriptionDrosophila ananassae miR-311a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   cc      ucu     a      uu   u       gaua 
5'   agauua   ucagg cgguau  gug caauaug    u
     ||||||   ||||| ||||||  ||| |||||||    u
3'   ucuagu   agucc gccaua  cac guuauac    u
   -c      ---     g      uu   -       aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13266: 4132931-4133008 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-311a
dan-mir-311bscaffold_13266: 4132538-4132607 [+]
dan-mir-312scaffold_13266: 4132689-4132745 [+]
dan-mir-311ascaffold_13266: 4132931-4133008 [+]
dan-mir-310scaffold_13266: 4133049-4133138 [+]
Database links

Mature sequence dan-miR-311a

Accession MIMAT0008471
Sequence

50 - 

uauugcacuuauaccggccuga

 - 71

Get sequence
Evidence by similarity; MI0000423

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).