Stem-loop sequence dan-mir-31b

AccessionMI0009006 (change log)
DescriptionDrosophila ananassae miR-31b stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   au     a     uc  a       -agagcacaga ga   ag   g 
5'   uuggc agaug  gg auagcug           g  ucg  cga u
     ||||| |||||  || |||||||           |  |||  |||  
3'   aacug ucuac  cc uaucggc           c  agc  gcu c
   -u     a     -u  g       gaaaccuuaag ag   ca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13047: 712447-712541 [-]
intergenic
Database links

Mature sequence dan-miR-31b

Accession MIMAT0008469
Sequence

4 - 

uggcaagaugucggaauagcug

 - 25

Get sequence
Evidence by similarity; MI0000410

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).